Similar For SUPPORT User Manuals |
---|
More SUPPORT User Manual |
---|
# | Title | Type | Language | Download |
1. |
A257_M256_UsersGuide - Support
ES PROYECTOR DE DATOS Serie XJ A XJ A142 XJ A147 XJ A242 XJ A247 XJ A252 XJ A257 Serie XJ M XJ M141 XJ M146 XJ M151 XJ M156 XJ M241 XJ M246 XJ M251 XJ M256 Modelos USB Guia del usuario En este manual Serie XJ A y Serie XJ M se refieren solamente a los modelos especificos mencionados arriba e Aseg rese de leer las Precauciones para su seguridad y Precauciones de funcionamiento en el documento Gu a de configuraci n sumini |
PDF Manual |
ENGLISH |
![](/D.jpg) |
2. |
User Manual - Support Sagemcom
MAGIC 5 User Manual PHILIPS Dear Customer In purchasing this machine you have decided on a quality PHILIPS product Your machine satisfies the full range of requirements for private use or in everyday office and busi ness environments Your machine is sold with a free ink film inserted for a few test pages You do not require a Plug n Print card for this ink film chip card with information on the ink film ca pacity In the telephone book of your machine |
PDF Manual |
ENGLISH |
![](/D.jpg) |
3. |
Guía del usuario de CA Agile Vision - Support CA
CA Agile Vision Guia del usuario Winter 2012 Esta documentaci n que incluye sistemas incrustados de ayuda y materiales distribuidos por medios electr nicos en adelante referidos como la Documentaci n se proporciona con el nico prop sito de informar al usuario final pudiendo CA proceder a su modificaci n o retirada en cualquier momento Queda prohibida la copia transferencia reproducci n divulgaci n modificaci n o duplicado de la totalidad o parte de esta |
PDF Manual |
ENGLISH |
![](/D.jpg) |
4. |
Receptor StarFire 3000 - stellarsupport global
StarFire 3000 MANUAL DO OPERADOR StarFire 3000 OMPFP10345 EDI O FO PORTUGUESE John Deere Ag Management Solutions RINTED IN THE U S A DCY OMPFP10345 Introdu o www StellarSupport com NOTA Devido a altera es no produto realizadas ap s a impress o deste documento poss vel que suas funcionalidades n o estejam completamente descritas aqui Leia o Manual do Operador e o Guia de Consulta R pida mais recentes antes da opera o Para obter u |
PDF Manual |
ENGLISH |
![](/D.jpg) |
5. |
Precompiler User`s Manual - ALTIBASE Customer Support
Altibase Application Development Precompiler User s Manual Release 6 1 1 February 4 2013 Z LTIBASE Altibase Application Development Precompiler User s Manual Release 6 1 1 Copyright 2001 2012 Altibase Corporation All rights reserved This manual contains proprietary information of Altibase Corporation it is provided under a license agreement containing restric tions on use and disclosure and is also protected by copyright patent and other intellectual pro |
PDF Manual |
ENGLISH |
![](/D.jpg) |
6. |
Mbox Basics Guide.book - Digidesign Support Archives
Mbox Basics Guide Version 6 7 for LE Systems on Windows XP or Mac OS X Digidesign 2001 Junipero Serra Boulevard Daly City CA 94014 3886 USA tel 650 731 6300 fax 650 731 6399 Technical Support USA tel 650 731 6100 fax 650 731 6384 Product Information USA tel 650 731 6102 tel 800 333 2137 International Offices Visit the Digidesign Web site for contact information Web Site www digidesign com a ww celigidesig mn Copyright This guide is |
PDF Manual |
ENGLISH |
![](/D.jpg) |
7. |
Pupitre tactil TP 070 - Service, Support
SIEMENS SIMATIC HMI Pupitre tactil TP070 Manuel produit 6AV6591 1DC01 1AC0 Edition 03 00 Entretien maintenance 10 Actualisation du syst me 11 d exploitation Annexes Glossaire Index Regles de securite Ce manuel donne des consignes que vous devez respecter pour votre pros curit ainsi que pour viter des dommages mat riels Elles sont mises en vidence par un triangle d avertissement et sont pr sent es selon le risque encouru de la fa on |
PDF Manual |
ENGLISH |
![](/D.jpg) |
8. |
Ultimate Support Systems Plumbing Product CUSTOM-6 user manual
THE STRENGTH OF INNOVATION CUSTOM MIC STAND SETTING THE STAGE FOR LEAD SINGERS Ergo one handed clutch holds better then any other one handed stand SMELL THE RUBBER CUSTOM 6 Rev 1 04 30 09 Hang Tag Item 16775T s FEATURES OF CUSTOM 6 Extreme Style Following in the tradition of Ultimate Support s Colorado Custom mic stand the Ultimate Support Custom Series Mic Stands feature detailed themed base and matching clutches in a variety of i |
PDF Manual |
ENGLISH |
![](/D.jpg) |
9. |
fx-570_991LA_PLUS - Support
fx 570LA PLUS fx 991LA PLUS Guia del usuario Sitio web educativo para todo el mundo de CASIO http edu casio com CASIO ndice Informaci n importante 52 5 armada rancia rne cacon 2 Operaciones de nennen 2 Inicio de la 2 Precauciones de 2 Precauciones |
PDF Manual |
ENGLISH |
![](/D.jpg) |
10. |
Technical Information - Multiquip Service & Support Center
VV a j Technical Information ot Group TRAILERS MULTIQUIP TRAILER INSPECTION SERVICE TRAILER INSPECTION AND SERVICE e Always Inspect safety hooks for damage before leaving yard e Inspect all lights for proper operation e Verify all documents are up to date and in the document box e Verify the ball hitch on the trailer matches the ball on the tow vehicle e Inspect trailer for loose or damaged components and fasteners RUNNING GEAR INSPECTION AND SERVICE e Alw |
PDF Manual |
ENGLISH |
![](/D.jpg) |
11. |
Remote Access Support
emoteoc Access Assess Resolve Provide technical support or training remotely anywhere anytime For any assistance call us at 1 800 949 3555 On business days from 6 00 AM to 6 00 PM PST right Pro Softnet Corporation All rights reserved mo Epc User Manual Copyright Pro Softnet Corporation All rights reserved 2 of 24 emotepc User Manual Remote Access Helpdesk User Manual TABLE OF CONTENTS Lai aeol leila E 4 Features cre as EEE |
PDF Manual |
ENGLISH |
![](/D.jpg) |
12. |
collari e sistemi di fissaggio brackets for pipe supports and fixing
COLLARI E SISTEMI DI FISSAGGIO BRACKETS FOR PIPE SUPPORTS AND FIXING SYSTEMS ROHSCHELLEN UND ROHRBEFESTIGUNGEN SYSTEME COLLIERS DE FIXATION POUR TUBES LS Y SISTEMAS DE FIJACION I INDICE GENERALE INDEX e INHALTSVERZEICHNIS INDEX e INDICE Collari fissaggio tubi Collars for pipe clamping Befestigungen fur rohre Colliers de fixation pour tube Abrazaderas fijacion tubo Sistemi di fissaggio sanitari Sanitary fixing systems Befestigungssysteme f r |
PDF Manual |
ENGLISH |
![](/D.jpg) |
13. |
KL-780 - Support
Guia del usuario Precauciones de seguridad importantes Antes de usar la rotuladora por primera vez tenga en cuenta las precauciones de seguridad siguientes Guarde esta precauciones de seguridad e instrucciones de operaci n en un lugar pr ctico para usar como referencias futuras Acerca de los s mbolos de precauciones Los s mbolos siguientes que se usan en este manual el producto propiamente dicho son para advertir de posibles riesgos de lesiones personales |
PDF Manual |
ENGLISH |
![](/D.jpg) |
14. |
Operating Instructions - Support
Panasonic Operating Instructions Digital Camera v n DMIC FZ30PP Before connecting operating or Ss P adjusting this product please read the instructions completely LEICA DC VARIO ELMARIT For USA assistance please call 1 800 272 7033 or send e mail to digitalstillcam panasonic com For Canadian assistance please call 1 800 561 5505 or visit us at www panasonic ca VQTOR81 Before Use Dear Customer We would like to take this opportun |
PDF Manual |
ENGLISH |
![](/D.jpg) |
15. |
BN-20 New Owners Guide - Support
Roland VersaSTUDIO SIGN MAKER BN 20 Basic Course for BN 20 Roland DG Academy Table of Contents MA OCC UOR sx rssncse ohese oes nner ecient EEEREN E EEE AKEE EE EENAA 1 Functions and Applications for BN 20 ccc cece c cece cece eee eeaeeeeeseeeeeaaas 1 1 Output Data Preparation Creating Output Data dua nude ccunicndaciewiedansacctonmi gunn eddas audtosiwiewn oataadawndatiedensionndbes 2 COAG CUNI OLE serrana E E a 5 Metallic Silver Graphic Data C |
PDF Manual |
ENGLISH |
![](/D.jpg) |
16. |
R0E521500MCU00 User`s Manual Supported Devices: R8C Family
7 CD m n lt a ROES21500MCU00 User s Manual Supported Devices R8C Family R8C 5x Series All information contained in these materials including products and product specifications represents information on the product at the time of publication and is subject to change by Renesas Electronics Corporation without notice Please review the latest information published by Renesas Electronics Corporation through various means including the Renes |
PDF Manual |
ENGLISH |
![](/D.jpg) |
17. |
Service Manual - Support
SPILL PROOF SPILL PROOF CUTS Service Manual First Edition August 2002 Last Revision April 2013 Document 720003 0000 SPILL PROOF SPILL PROOF CUTS Nano Service Manual Legal Notices Disclaimer Information in this document is subject to change without notice Consult your Nanoptix Inc sales representative for information that is applicable and current Nanoptix Inc reserves the right to improve products as new technology components softwar |
PDF Manual |
ENGLISH |
![](/D.jpg) |
18. |
User Manual - MEI`s Technical Support
KOLLMORGEN www DanaherMotion com PicoDAD SN Compact Dual Axis SynqNet Servo Drive User Manual Revision No 2 0 Date 30 January 2006 Solutions by DANAHER MOTION Danaher Motion Kollmorgen January 30 2006 Table Of Contents 1 Revisi n Hist ry AAA TT 2 CONVENIOS iii cir ao 3 Product Descrip o rr bi ssas raose Raro 3 1 GENERAL neta de a llo e dad E en E 9 3 2 SY NONETO ui a ii 9 3 3 PART NUMBER cocineta dalla A E EE S SEES iia 10 3 4 ELECTRICAL |
PDF Manual |
ENGLISH |
![](/D.jpg) |
19. |
TruSeq RNA Sample Preparation v2 Guide - Support
ilumina TruSeo RNA Sample Preparation v2 Guide ACGAAAAGAATGATAACAGTAACACACTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATATTAACGTACCATTAAGAGCTACCGT AATGATAACAGTAACACACTTCTGTTAACCTTAAGAT TACTTGT TGATCCACTGATTCAACGTACCGTATCAATTGAGACTAAATAT TAACGTACCATTAAGAGCTACCGTCTTCTGT TAACCTTAAGAT TACT TGATCCACTGAT TCAACGTACCGTAA nd EGA Tt Te ta CGT ACCAT TAAGAGCTACCGTCTTCTGTT QATLA Y |
PDF Manual |
ENGLISH |
![](/D.jpg) |
20. |
Phénix + 740 HD - Accueil support VIsiole :: Accueil
Ph nix 740 HD AS Manuel d utilisation Ph nix 740 HD VISIO LE 4 rue L on Blum ZAE les Glaises 91120 Palaiseau HIMS 139 9 Gajung dong Yuseong gu Daejeon KOREA 305 350 www himsintl com T 82 42 864 4460 F 82 42 864 4462 Ph nix 740 HD Table des mati res Vile Ph nix 740 Data ra lo ti 3 2 Pr cautions de S curit oooocooccocconccnnconccnnconaconconcconconnnonos 5 9 Contenu du Coll iria da cas 6 A A nm dns 3 |
PDF Manual |
ENGLISH |
![](/D.jpg) |