AVhjrlp l DOOR AND PANEL PARTS For Models GU2455XTSB0 GU2455XTSQ0 GU2455XTST0 GU2455XTSS0 Black White Biscuit Stainless 0 UNDERCOUNTER DISHWASHER lllus Part No No DESCRIPTION 1 Literature Parts 8575348 Instructions Installation 8575901 Energy Guide 8575899 Guide Use amp Care Tech Sheet 8572216 English French 2 Arm Hinge 8534858 Left 8534857 Right 3 8268983 Stiffener Door 4 Panel Front W100732
Whirlpool DOOR AND PANEL PARTS For Models GU3600XTSB2 GU3600XTSQ2 GU3600XTSY2 Black White Silver UNDERCOUNTER DISHWASHER lllus No Part No DESCRIPTION 1 Literature Parts W10021230 Instructions Installation W10102695 Energy Guide 8575899 Guide Use amp Care W10082651 Tech Sheet English French 2 Arm Hinge 8534854 Left 8534853 Right 3 8268983 Stiffener Door 4 Panel Front 8537066 Black 8537067
Ulus Part No No DESCRIPTION 1 Literature Parts W10162204 Owner s Manual W10134252 Tech Sheet W10141166 Installation Instructions Template Anti Tip 9757143 English French 9757142 English Spanish 9762761 Brochure Tips Safe Cooking lllus Part No No DESCRIPTION 2 Cooktop W10134940 White W10134939 Black W10134941 Biscuit 3 Element Surface 8523047 2400 1000 W LF 8273994 1200W LR amp RR 8273992 2500 W RF lllus Part No No DESCRIPTION 4 Bracke
Whirlpool Undercounter Dishwasher CORPORATION PRODUCT MODEL NUMBERS OVERALL DIMENSIONS DU1048XTP DU1055XTP DU1055XTS DU1100XTP DU1101XTP DU1145XTP DU1148XTP DUC600XTP DUL240XTP GU2200XTS GU2300XTS GU2370XTS GU2400XTP GU2455XTS GU2500XTP GU2548XTP GU2600XTP GU2700XTS Electrical 120 volt 60 Hz AC only 15 or 20 amp fused electrical supply Use copper wire only A time delay fuse or circuit breaker and separate circuit is recommended
HGAT lt GLO No one builds a better fire Model s Supreme XTS Grand XTS Owner s Manual Installation and Operation GAS FIRED This applian amp e has been retired Service parts pages within have been reinr gt oved For replacernonl parts please refer to the individual service parts list located on the braind websites CAUTION DO NOT DISCARD THIS MANUAL Important operating and maintenance instructions included Read understand and follow these in
fir door and panel parts Whirlpool For Models DU1055XTSB2 DU1055XTSQ2 DU1055XTST2 DU1055XTSS2 7 Black White Biscuit Stainless UNDERCOUNTER DISHWASHER lllus Part No No DESCRIPTION 1 Literature Parts 8575348 Instructions Installation W10102783 Energy Guide W10073760 Guide Use amp Care W10082651 Tech Sheet 2 Arm Hinge 8534858 Left 8534857 Right 3 8268983 Stiffener Door 4 Panel Front W10073170 Black W10073180 White W10073190 Biscui
5 3 Parts List N S ac gt lt MOTOROLA MOTOROLA XTS5000 Series Parts List Model I REF REF NO PART NO DESCRIPTION NO PART NO DESCRIPTION 1 3305630201 Label Motorola Bottom part of item 2 26 0660076B05 Resistor 150kQ part of item 18 2 1585468D07 Assembly Model Housing St
AVhjrljH l DOOR AND PANEL PARTS For Models GU2455XTSB2 GU2455XTSQ2 GU2455XTST2 GU2455XTSS2 Black White Biscuit Stainless UNDERCOUNTER DISHWASHER lllus Part No No DESCRIPTION 1 Literature Parts 8575348 Instructions Installation W10102784 Energy Guide 8575899 Guide Use amp Care W10082651 Tech Sheet 2 Arm Hinge 8534858 Left 8534857 Right 3 8268983 Stiffener Door 4 Panel Front W10073200 Black W10073210 White W10073220 Biscuit 8269845
PerlelOG Media Converters Installation Guide S 10G STS S 10G XTS S 10G XTX S 10G XTSH S 10G XTXH P N 5500325 10 Overview This document contains instructions necessary for the instaiiation and operation of the Perie S 10G Standaione Media Converters The Perie S 10G Standaione Media Converters are 10 Gigabit Media Converters with two piuggabie transceiver ports The S 10G supports iow power transceivers whereas the S 10G XTSH and the S10G XTXH support high p
DOOR AND PANEL PARTS For Models GU2700XTSB0 GU2700XTSQ0 GU2700XTST0 GU2700XTSS0 GU2700XTSY0 Black White Biscuit Stainless Silver Whirlpool 0 UNDERCOUNTER DISHWASHER lllus Part No No DESCRIPTION 1 Literature Parts 8575348 Instructions Installation 8575901 Energy Guide 8575899 Guide Use amp Care Tech Sheet 8572216 English French 2 Arm Hinge 8534858 Left 8534857 Right 3 8268983 Stiffener Door 4
CABINET PARTS For Models GB2SHDXTQ11 GB2SHDXTB11 GB2SHDXTS11 GB2SHDXTL11 White Black Stainless Steel Satina lllus Part lllus Part lllus Part No No DESCRIPTION No No DESCRIPTION No No DESCRIPTION 1 Literature Parts 11 67006473 Screw 22 67001097 Cover Water Valve W10137645 Use amp Care Guide 12 67003331 Cover Water Line 23 12575101 ED Cover Unit W10179468 Energy Guide 13
English 205 Business Writing Course Syllabus Section 228 Online Web Instructor Dr Sally Stanton Semester Fall 2011 Course Desire 2 Learn D2L web site https uwm courses wisconsin edu Email stanton uwm edu Office Hours Online or by appointment UWM Phone 414 229 5007 Home Office 414 231 9228 bus hrs Office Curtin 288 Required TEXTS RESOURCES Alred Gerald et al The Business Writer s Handbook 9 edition 3 Guffey Mary Ellen Business C
AVhjrljH l DOOR AND PANEL PARTS For Models GU2455XTSB2 GU2455XTSQ2 GU2455XTST2 GU2455XTSS2 Black White Biscuit Stainless UNDERCOUNTER DISHWASHER lllus Part No No DESCRIPTION 1 Literature Parts 8575348 Instructions Installation W10102784 Energy Guide 8575899 Guide Use amp Care W10082651 Tech Sheet 2 Arm Hinge 8534858 Left 8534857 Right 3 8268983 Stiffener Door 4 Panel Front W10073200 Black W10073210 White W10073220 Biscuit 8269845
WWrlp oI DOOR AND PANEL PARTS For Models GU2300XTSB0 GU2300XTSQ0 GU2300XTST0 GU2300XTSS0 Black White Biscuit Stainless i UNDERCOUNTER DISHWASHER lllus No Part No DESCRIPTION 1 Literature Parts 8575348 Instructions Installation W10102750 Energy Guide W10073760 Guide Use amp Care W10082651 Tech Sheet 2 Arm Hinge 8534858 Left 8534857 Right 3 8268983 Stiffener Door 4 Panel Front Includes
illumina Guida del sistema NextSeg 550 GAAAAGAATGATAACAGTAACACACTTCTGTTAACCTTAAGATTACTTGATCCACTGATTOAACGTACCGTAAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATATTAACGTACCATTAAGAGCTACI TGATAACAGTAACACACTTCTGTTAACCTTAAGATTACTTGTTGATCCACTGATTCAACGTACCGTATCAATTGAGACTAAATATTAACGTACCATTAAGAGCTACCGTCTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCG gt CACTGATTCAACGTACCAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATATTAACGTACCATTAAGAGCTACCGTCTTCTGTTAACCTTAAGATTACTTGATC
Ejecuci n Configuraci n del experimento Funcionamiento del sistema NextSseq Y 500 Requisitos 3 Preparaci n de la celda de flujo 5 Biblioteca preparada y cuantificada o bibliotecas agrupadas Kit NextSeq 500 Alto rendimiento o rendimiento medio Opcional Kit de control PhiX de Illumina Gu a del usuario del sistema NextSeq 500 En la interfaz de NCS seleccione Sequence Secuenciar La puerta de la celda de flujo se abre y el sistema se prepara para la
Hardware environmental compliance SMART Technologies supports global efforts to ensure that electronic equipment is manufactured sold and disposed of in a safe and environmentally friendly manner Waste Electrical and Electronic Equipment regulations WEEE Directive K Waste Electrical and Electronic Equipment regulations apply to all electrical and electronic equipment sold within the European Union When you dispose of any electrical or electronic equipment including SMART Tech
Q MOTOROLA Product Model Digital Portable Radio XTS 3000 Std Rugged Secure Rehabilitation Act Amendments of 1998 Section 508 Subpart 1194 25 Self Contained Closed Products The following features are derived from Section 508 COMMENTS When a timed response is required alert user allow sufficient time for him to indicate that he needs additional time to respond N A There is only 1 time limited complex function radio lock which has a user programmable tim
COMMERCIAL ANWREMIE Hi Power Blenders MX1000XT MX1050XT MX1100XT OPERATING MANUAL IMPORTANT SAFEGUARDS When using electrical appliances basic safety precautions should always be followed including the following k 2 11 14 15 16 READ ALL INSTRUCTIONS To protect against electrical hazards do not immerse the blender base in water or other liquid Close supervision is necessa
FETCO User s Guide www fetco com FETCO Models CBS 2141xTS CBS 2142XTS Fetco CBS 2141XTS amp CBS 2142XTS Extractor Touch Screen models shown with optional LUXUS L3D dispewsery 1 gallon Hot Beverage Brewers Standard Electrical Configuration Commercial Hot Beverage Equipment Table of Contents Contact Information 2 Menu Features Batch Parameters T Description am