No 30451 ILLUMINATED 2inl SOLITAIRE OPERATING INSTRUCTIONS BATTERY INSTALLATION Unscrew the battery cover with a Phillips screwdriver Insert 2 AAA 1 5V batteries with the positive and negative ends facing in the proper direction as indicated in the battery compartment see Fig 1 Replace the cover SAFETY BATTERY USAGE Different types of batteries or new and used batteries are not to be mixed Non rechargeable batteries are not
Dolan Jenner industries Operation Manual Fiber Lite MI 150 ILLUMINATOR A Product of Dolan Jenner Industries Introduction The Fiber Lite MI 150 is a 150 Watt quartz halogen fiber optic illuminator designed for general microscopy use When used with specialty fiber optic cables the MI 150 illuminator can also be used in a variety of laboratory illumination applications e Initial Setup O Remove the MI 150 Illuminator from the carton and retain the manual and an
Basler Sensic HPLL ILLUMINATION MODULE SERVICE MANUAL AND TROUBLESHOOTING GUIDE Document Number AWOO1189 Version 06 Language 000 English Release Date 14 March 2014 BASLER the power of sight This Manual This manual is designed to give service instructions and troubleshooting information for the Basler SENSIC HPLL illumination module It contains important information on how to service the illumination module safely properly and most efficiently Observ
CUDA SURGICAL HLS 150 Halogen Illuminator Operator Manual CE id ST Technologies 6018 Bowdendale Avenue 6025 Chester Ave Jacksonville FL 32216 USA Customer Service 904 208 2291 Toll Free 877 814 2237 EC REP RMS UK Ltd 28 Trinity Road Nailsea Somerset BS48 4NU United Kingdom TEL 01275 858891 LITO91 CUDA SURGICAL Rev G English Page 1 of 60 10 11 TABLE OF CONTENTS INTRODUCTION WARNINGS SPECIFICATIONS OP
illumina VariantStudio v2 2 Software User Guide o ANA EE TA T TA A TE TGATAACAGTAACACACTTCTGTTAACCTTAAGATTACTTGTTGATCCACTGATTCAACGTACCGTATCAATTGAGACTAAATATTAACGTACCATTAAGAGCTACCGTCTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCG gt CACTGATTCAACGTACCAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTAT CRT GAGACTARATATTAACOTACCALTNACAGCTACEGTCTECTGLAACCTIAAGATTAGTT GATCCACIGATICAACGTACCETAACG GAAAAGAAT CAGTAACACACTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAAAGATTACTTGATCCACTGATTCAAC
Illuminating Desktop Magnifier User Manual Model MAGO5 Quine lth Solutions Lighting Flip the switch within the magnifier from off to on see diagram The magnifier is now ready for use To turn LED lights on or off twist the magnifier head Magnification Twist the magnifier head to zoom from 5X to 6 YX Magnification To magnify with no ligithing flip the switch within the magnifier from on to off see diagram Battery Replacement Slide the bat
SureSelect Automated Target Enrichment for Illumina Multiplexed Sequencing Featuring Transposase Based Library Prep Technolog Automated usi gilent NGS Bravo Option A Proto Version BO Nove SureSelect platform manufactufgm with Agilent SurePrint Technology For Research Use Only Not for use in diagnostic procedures Apg Agilent Technologies Notices Agilent Technologies Inc 2015 No part of this manual may be reproduced in any form or by any
ProXenon 350 Surgical Illuminator Directions for Use REF 902 Series WelchAllyn Advancing Frontline Care ii Copyright Information Welch Allyn ProXenon 350 Surgical Illuminator Copyright 2008 Welch Allyn All rights are reserved No one is permitted to reproduce or duplicate in any form this manual or any part thereof without permission from Welch Allyn Welch Allyn assumes no responsibility for any injury to anyone or for any illegal or improper use of the pr
WelchAllyn Service Manual CL 300 Surgical llluminator SolarTec Source 270 CL 100 Surgical llluminator SolarTec Source 100 Welch Allyn Lighting Products 4619 Jordan Road Skaneateles Falls NY 13153 0187 PN LB MAN CLSERV Rev B Rev Description ECN Date Approved A New release 0 1013 2002 08 20 D Rutan B Update final inspection D 2010 01 06 D D See SAP DIR for change number approver name and date of a
IMo 20700 20705 m SU illuminated doku TM OPERATING INSTRUCTIONS BATTERY INSTALLATION batteries included Unscrew the battery cover with a Phillips screwdriver Insert 2 AAA batteries with the positive and negative ends facing in the proper direction as indicated in the battery compartment see Fig 1 Replace the cover SAFETY BATTERY USAGE Different types of batteries or new and used batteries are not to be mixed Non rec
e CHANNEL VISION _ 6344 1 8 Megapixel Bullet Wireless IP Camera w 39 IR iluminators Table Of Contents 163 PREC RAR A E RR RR I Page 3 A 111 Ce E RE E ZAR Page 4 Cable Pin Out T HA Page 5 Option One Assigning an IP Address DHCP Connecting To The IP Camera DACP 00 cc cccsces
Manuale di installazione e d uso Telecamera diurna notturna da 1 3 con illuminazione IR VKC 1353 IR eneo Indice 1 Istruzioni di SICUFEZZa uiiiii 3 2 Descrizione GenEralo iiiiii 3 di 1 Descrizione e funzionam eno e WWWUW W W UWW WuwWwWwWwe i I 4 4 Collegamenti iii 6 4 1 Collegamento all alimentazione elettrica iiiiiii 6 4 2 Collegamento al monitor 5 Impostazioni obiettivo ii
SCOPELED G150 SERIES ILLUMINATOR OPERATION MANUAL Table Top Pole Mount S SCOPELED illuminating your view COPYRIGHT 2015 2016 ScopeLED All rights reserved Printed in the United States of America This manual may not be reproduced in whole or in part in any form or by any means without the express written permission of ScopeLED NO LIABILITY FOR ERRORS ScopeLED reserves the right to correct technical and typographical errors in this manual at any time
SCOPELED G250 SERIES ILLUMINATOR OPERATION MANUAL Table Top Pole Mount IS SCOPELED illuminating your view COPYRIGHT 2015 2016 ScopeLED All rights reserved Printed in the United States of America This manual may not be reproduced in whole or in part in any form or by any means without the express written permission of ScopeLED NO LIABILITY FOR ERRORS ScopeLED reserves the right to correct technical and typographical errors in this manual at any time
TransLite medical transillumination Veinlite 220 P User Manual www veinlite com e IMPORTANT Veinlite is a device which allows the physician to obtain more information about superficial veins This information should be incorporated with the patient history and other examination information to aid the physician in making a diagnosis Veinlite data should not be used as the only basis for making a clinical diagnosis of vein disease CAUTION Federal law restricts
EpiNext Post Bisulfite DNA Library Preparation Kit Illumina Base Catalog P 1055 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE Uses The EpiNext Post Bisulfite DNA Library Preparation Kit Illumina is suitable for preparing a DNA library for various Illumina platform based bisulfite sequencing bisulfite seq assays such as whole genome bisulfite sequencing WGBS oxidative bisulfite sequencing oxBs seq reduced representative bisulfite sequencing RRBS and ot
PG2000 Owner s Manual Specifications Electrical Operating load Material Weight Lamp Lamp Life Restrike time 120 VAC 60 Hz 2 amps High Strength Plastic 20 lbs 150 Watt Metal Halide 6000 hours 2 3 minutes Pentair Water Pool and Spa Inc 1620 Hawkins Ave Sanford NC 27330 800 831 7133 919 566 8000 10951 West Los Angeles Ave Moorpark CA 93021 800 831 7133 805 553 5000 Visit us on the Internet at www pentairpool com
Piko Plate Illuminator Quick user guide The Piko Plate Illuminator assists in loading samples into 24 or 96 well Piko PCR Plates using any standard pipettor It brightly illuminates the target well or wells with a white light Pre programmed loading patterns are included for single channel 8 channel and 16 channel pipettors Keypad layout d d Power key Select program Light all wells Pipettor selection Plate Illuminator r s r 16 1 m AD
npg 2012 Nature America Inc All rights reserved PROTOCOL A multispectral optical illumination system with precise spatiotemporal control for the manipulation of optogenetic reagents Jeffrey N Stirman Matthew M Crane Steven J Husson Alexander Gottschalk amp Hang Lu School of Chemical and Biomolecular Engineering Georgia Institute of Technology Atlanta Georgia USA Interdisciplinary Program in Bioengineering Institute of Biosciences and
Haier TV a schermo piatto con retroilluminazione a LED MANUALE DI ISTRUZIONI LE22G690CF Prima di iniziare a utilizzare l unit leggere attentamente questo manuale e conservarlo per consultazioni future Fissaggio del piedistallo Nota le seguenti immagini sono a puro scopo illustrativo 1 Com ponenti necessari per installare il piedistallo VORO Prima di installare il piedistallo assicurarsi che tutti i componenti siano presenti e non danneggiati Nel caso in cu